Skip to main content

DNA Link Project

CAGTACCAAGTGACTGAATATAAGCAGAACAGACGGCCATGCATCCGG

Comments

  1. CheyApril 20, 2018 at 9:26 PM

    I think your sentence says " I THINK IT IS TIME FOR ME TO BE GOOD AT SCHOOL"

    ReplyDelete
  2. L RodriguezApril 21, 2018 at 12:17 AM

    Good code and good decode. Well done to both of you.

    Here is my decode for reference:

    DNA: AGTACCAAGTGACTGAATATAAGCAGAACAGACGGCCATGCATCCGG
    RNA: UCAUGGUUCACUGACUUAUAUUCGUCUUGUCUGCCGGUACGUAGGCC
    Codons: AUG GUU CAC UGA CUU AUA UUC GUC UUG UCU GCC GGU ACG UAG
    (start) I think it is time for me to be good at school. (stop)

    ReplyDelete

Post a Comment

Popular posts from this blog

Language Blog

Part 1 Part one of this assignment I did at Universal Studios with my family. I was not a loud to talk at least with using words or using different forms of language. Even though it was kind of difficult, it was not impossible. They kept trying to ask my deep questions that were a little more than a nod of the head or just a simple laugh. They were actually quite impossible to answer so I just glared at them instead. They did keep trying to ask me questions and different forms of questions to try and get me to crack. I was in a small group of people however it was one person that kept talking to me and trying to crack me and yes, he definitely controlled the conversation, he was the one changing the topics, and he asked all of the questions while I ‘tried’ to answer. I was not really excluded too much also, it was almost like I got more attention since they felt the need to crack me. My partner definitely had the power for this fifteen minutes. Like I said he lead all the que...
1 comment
Read more

Homology vs. Analogy

Dogs and humans both have a homologous trait, the dogs leg and a humans arm. Dogs legs are used for walking, where humans do not tend to use their arms for walking. Humans use their arms for all kinds of different things like carrying heavy things and just about anything you can think of since your arms and hands are almost one in the same, you can use them for writing, typing, art or endless possibilities. Dogs legs have the main purpose of walking. Humans can get down on all fours, but it is not as comfortable or natural as a dog. likewise for a dog, they can stand on two legs but its not very natural for them, that would be kind of cute though! however they do have almost the same structure and the same amount of bones as each other. A butterfly and a bat have analogous traits. Both of these creatures have wings and they both use them to fly. I do think a common ancestor could have had wings as well which were passed all the way down to these two very different species.
1 comment
Read more